The short version of fatty acid oxidation fits in a sentence. The long version — which is the one that helps — is below.
This page was last updated on 2026-04-23 and is reviewed periodically as new material appears.
In laboratory settings, cardarine is studied as a tool compound for probing PPARδ biology. Published experiments often use cell cultures, rodent models, or isolated tissues. Some investigations focus on metabolic effects, while others assess potential risks such as carcinogenicity observed in long-term animal studies. Because human trials are sparse, most knowledge comes from preclinical work and adverse event reports. Scientific literature frequently notes the gap between animal findings and human outcomes. The compound is not a dietary supplement and is not intended for human consumption.
Cardarine is a common name for GW501516, a synthetic compound developed in the 1990s through research collaborations involving GlaxoSmithKline. It belongs to a class of molecules known as peroxisome proliferator-activated receptor delta agonists. Early studies explored its effects on lipid metabolism and energy expenditure in animal models. The compound was never approved as a human medicine, and clinical development was discontinued. In the years since, it has appeared in fitness and bodybuilding communities as a performance-enhancing substance. Regulatory agencies classify it as an unapproved drug.
Preclinical research reported that GW501516 increased running endurance in mice and improved lipid profiles in some animal species. Early human trials explored effects on high-density lipoprotein cholesterol, triglycerides, and glucose handling, but the program was discontinued. Published human data are sparse and do not establish efficacy for any condition. Studies also examined PPAR delta in cancer biology, with conflicting findings across models. The relationship between receptor activation, tissue context, and disease risk remains an active area of investigation.
Anti-doping laboratories identify GW501516 and its metabolites using liquid chromatography-tandem mass spectrometry. Urine is the usual matrix, and detection can occur after the parent compound has cleared from blood. The exact detection window depends on dose, formulation, individual metabolism, and assay sensitivity. Because the compound is prohibited at all times, athletes are subject to testing in and out of competition. Analytical methods continue to improve as new metabolites and designer analogs are characterized.
GW501516 acts as a ligand for PPAR delta, a nuclear receptor that regulates transcription of genes involved in fatty acid oxidation and energy use. Activation of this receptor in skeletal muscle shifts metabolism toward fat burning in animal models. The compound does not burn fat directly; it changes gene expression over hours to days. Researchers study it to understand metabolic flexibility and exercise adaptation. Effects observed in rodents are not automatically expected in humans.
| Property | Value | Notes |
|---|---|---|
| CAS Registry Number | 317318-70-0 | Unique identifier for the compound. |
| Chemical class | PPARδ agonist | Synthetic ligand for peroxisome proliferator-activated receptor delta. |
| Appearance | White to off-white solid | Typical form of research-grade material. |
| Solubility | Soluble in DMSO and ethanol | Poorly soluble in water. |
| Typical storage | -20°C | Recommended for long-term storage of stock solutions. |
Legal status varies by country. In some places, cardarine is controlled under medicines or psychoactive substances laws; in others, it may be sold with minimal oversight as a research chemical. Customs agencies have intercepted shipments, and several national health agencies have issued warnings about products marketed for bodybuilding or performance enhancement. The lack of a standardized pharmaceutical supply means identity, purity, and contamination levels can differ widely between samples. These factors make cardarine a regulatory and public health concern rather than a conventional prescription drug.
Cardarine is a common name for GW501516, a synthetic compound first described in the 1990s as a selective agonist of the peroxisome proliferator-activated receptor delta. It was studied in preclinical models for metabolic and cardiovascular conditions, but it has not been approved as a medicine in the United States, Europe, or other major jurisdictions. Retail products labeled as cardarine are generally research chemicals or supplements, not pharmaceutical formulations. Because human safety and efficacy data remain limited, regulatory agencies treat it as an unapproved substance rather than a therapeutic product.
Detection of GW501516 in biological samples generally relies on liquid chromatography coupled with tandem mass spectrometry. Urine is a common matrix in anti-doping analysis, while blood or plasma may be used in research settings. Sample preparation can involve enzymatic hydrolysis, protein precipitation, or solid-phase extraction before instrumental analysis. Because the compound undergoes metabolism, assays may target the parent molecule, one or more metabolites, or both. Detection windows are not fixed; they depend on factors such as dose, route, individual metabolism, and assay sensitivity. Reference standards are required for accurate identification and quantification.
Handling and quality assessment of cardarine reference material follow general laboratory practices for poorly characterized compounds. It typically appears as a white to off-white powder and is sparingly soluble in water but soluble in organic solvents such as dimethyl sulfoxide and ethanol. Storage recommendations usually specify a cool, dry, dark place, with long-term storage at low temperature and desiccation. Purity may be checked by high-performance liquid chromatography with ultraviolet detection, while identity is confirmed by mass spectrometry and nuclear magnetic resonance. No pharmacopeial monograph exists, so reported purity and stability depend on the supplier’s methods.
GW501516 binds and activates PPARδ, a nuclear receptor that influences transcription of genes involved in fatty acid oxidation and energy use. Activation shifts some metabolic pathways in preclinical models, which is why the compound has been studied for lipid disorders and exercise-related endpoints. The exact downstream effects in humans are incompletely mapped. PPARδ is expressed in many tissues, including skeletal muscle, liver, and adipose tissue, so broad activation may have varied consequences. Researchers continue to examine how selective or partial activation might alter the balance between benefits and risks.
Published human data are sparse and mostly come from early-phase trials. Those studies examined short-term changes in lipids, glucose, and exercise capacity, but they were not large enough to establish efficacy or long-term safety. Some animal experiments reported increased running endurance, yet such findings do not prove a performance benefit in people. Anti-doping laboratories detect GW501516 and its metabolites in urine or blood using liquid chromatography-tandem mass spectrometry. Detection windows depend on dose, sample type, and individual metabolism. The method is sensitive enough to identify trace residues in tested samples.
=== Defence testimony === Ferguson emphasised that Fred, before meeting Rose, had committed at least one murder strikingly similar to those at issue in the present trial, and that the prosecution's case was largely circumstantial. He contended that Rose was unaware of the extent of Fred's sadism and urged the jury not to be prejudiced by her promiscuity and domineering manner. Against the advice of her counsel, Rose herself testified; her affect sometimes morose and tearful, sometimes upbeat and humorous. She wept while describing herself as a victim of child sexual abuse who naively married a violent and domineering man, but joked about issues such as her "always being pregnant" and laughed while describing one victim's "grandfather glasses". Rose also claimed never to have met six of the victims buried at Cromwell Street, and to recall very little of her assault on Owens. When shown photographs of the victims buried in the cellar and of victim Alison Chambers, and asked by Leveson whether she recognised any of their faces, Rose's face turned bright red and she repeatedly stuttered as she replied, "No, sir." When questioned about life at Cromwell Street, Rose claimed she and Fred had lived separate lives, which was inconsistent with the earlier testimony of witnesses who had visited or lodged at their address. In reference to her relationship with her eldest child, Rose admitted her relations with Heather were strained before claiming to the court that her daughter was a lesbian who had physically and psychologically abused her siblings.
== Description == C. chanhua forms its fruiting structures on the surface of its host, a cicada nymph. The fruiting structure can either cover the entire nymph body or only partially cover it. Sexual structures are not produced on these fruiting structures. Much more information is known about the asexual morph of this fungus because the sexual morph has been reportedly observed once in nature and never in the lab. Its asexual fruiting structures are synnema-like and produce conidiophores and conidia. The fruiting bodies have yellow stalk-looking structures with a white-ish, fluffy tip where the conidiophores are located.
Everybody's Live with John Mulaney is an American live variety talk show that premiered on Netflix on March 12, 2025. Serving as a continuation of the series Everybody's in LA, the show is hosted by comedian John Mulaney who also serves as the creator and an executive producer. Richard Kind serves as the show's announcer and sidekick. The series features monologues, guests, pre-taped sketches, and musical segments with field pieces shot around Los Angeles. In January 2025, it was reported that the show had received a two-season order.
(Rateable Values) (Scotland) Order 1993 (S.I. 1993/878) British Gas plc. (Rateable Values) (Scotland) Order 1993 (S.I. 1993/879) British Railways Board (Rateable Values) (Scotland) Order 1993 (S.I. 1993/880) British Telecommunications plc. (Rateable Values) (Scotland) Order 1993 (S.I. 1993/881) Glasgow Underground (Rateable Values) (Scotland) Order 1993 (S.I. 1993/882) Lochaber Power Company (Rateable Values) (Scotland) Order 1993 (S.I. 1993/883) Mercury Communications Ltd. (Rateable Values) (Scotland) Order 1993 (S.I. 1993/884) Mines and Quarries (Rateable Values) (Scotland) Order 1993 (S.I. 1993/885) Water Undertakings (Rateable Values) (Scotland) Order 1993 (S.I. 1993/886) National Health Service Act 1977 (Composition of Medical Practices Committee) Modification Order 1993 (S.I. 1993/887) A1 Trunk Road (Islington) Red Route Traffic Order 1993 (S.I. 1993/891) United Kingdom Central Council for Nursing, Midwifery and Health Visiting (Legal Assessors) (Amendment) Order 1993 (S.I. 1993/892) Nurses, Midwives and Health Visitors (Professional Conduct) Rules 1993 Approval Order 1993 (S.I. 1993/893) Non-Domestic Rating (Collection and Enforcement) (Amendment and Miscellaneous Provision) (No. 2) Regulations 1993 (S.I. 1993/894) A1 Trunk Road (Islington) (Bus Lanes) Red Route Traffic Order 1993 (S.I. 1993/895) A1 Trunk Road (Haringey) Red Route Traffic Order 1993 (S.I. 1993/896) A1 Trunk Road (Haringey) (Bus Lanes) Red Route Traffic Order 1993 (S.I. 1993/897) Act of Sederunt (Fees of Solicitors in the Sheriff Court) (Amendment) 1993 (S.I.
Sources: en.wikipedia.org
In pre-life, a 31 nucleotide D loop minihelix (GCGGCGGUAGCCUAGCCUAGCCUACCGCCGC) was ligated to two 31 nucleotide anticodon loop minihelices (GCGGCGGCCGGGCU/???AACCCGGCCGCCGC; / indicates a U-turn conformation in the RNA backbone; ? indicates unknown base identity) to form the 93 nucleotide tRNA precursor. To generate type II tRNAs, a single internal 9 nucleotide deletion occurred within ligated acceptor stems (CCGCCGCGCGGCGG goes to GGCGG). To generate type I tRNAs, an additional, related 9 nucleotide deletion occurred within ligated acceptor stems within the variable loop region (CCGCCGCGCGGCGG goes to CCGCC). These two 9 nucleotide deletions are identical on complementary RNA strands. tRNAomes (all of the tRNAs of an organism) were generated by duplication and mutation. Very clearly, life evolved from a polymer world that included RNA repeats and RNA inverted repeats (stem-loop-stems). Of particular importance were the 7 nucleotide U-turn loops (CU/???AA). After LUCA (the last universal common (cellular) ancestor), the T loop evolved to interact with the D loop at the tRNA "elbow" (T loop: UU/CAAAU, after LUCA). Polymer world progressed to minihelix world to tRNA world, which has endured for ~4 billion years. Analysis of tRNA sequences reveals a major successful pathway in evolution of life on Earth.
Br2 + H2O ⇌ HOBr + H+ + Br− (Kac = 7.2 × 10−9 mol2 dm−6) Br2 + 2 OH− ⇌ OBr− + H2O + Br− (Kalk = 2 × 108) Hypobromous acid is unstable to disproportionation. The hypobromite ions thus formed disproportionate readily to give bromide and bromate:
== History == Olaratumab was originally developed by ImClone Systems, which was acquired by Eli Lilly in 2008. A Phase I clinical trial was conducted in Japanese patients in September 2010, followed by a Phase II trial in 133 patients, starting in October 2010. In February 2015, the European Medicines Agency assigned olaratumab orphan drug status for the treatment of soft-tissue sarcoma. The European Commission granted a conditional marketing authorisation, based on the mentioned Phase II study, valid throughout the European Union on 9 November 2016. Previously considered a promising drug, the FDA granted olaratumab fast track designation, breakthrough therapy designation and priority review status. In October 2016, the US FDA issued an accelerated approval notice for use of olaratumab with doxorubicin to treat adults with certain types of soft-tissue sarcoma, based on the same study. A phase III trial completed in 2019, and unfortunately showed no benefit from the addition of olaratumab to doxorubicin. As noted above, these results led to withdrawal of approval in the United States and Europe.
=== Lactogenesis I and other changes in pregnancy === Changes in pregnancy, starting around 16 weeks gestational age, prepare the breast for lactation. These changes, collectively known as Lactogenesis I, are directed by hormones produced by the placenta and the brain, namely estrogen, progesterone, prolactin, which gradually increase throughout the pregnancy, and result in the structural development of the alveolar (milk-producing) tissue and the production of colostrum. While prolactin is the predominant hormone in milk production, progesterone, which is at high levels during pregnancy, blocks the prolactin receptors in the breast, thus inhibiting milk from "coming in" during pregnancy.
== Adverse effects == The most significant adverse effects associated with topiramate treatment are predominantly central nervous system (CNS) related. A notable proportion of patients, ranging from 11% to 28%, discontinue topiramate therapy due to adverse effects. People taking topiramate should be aware of the following risks:
Sources: en.wikipedia.org
Secondary U.S. sanctions prohibit any trading in U.S. dollars and prevent trade with a country, individuals, or organizations under the U.S. sanctions regime, affecting non-U.S. persons even where no U.S.-jurisdictional nexus existed. Primary sanctions, by contrast, restrict only U.S. companies, institutions, and citizens from doing business with sanctioned countries or entities. According to Rawi Abdelal, secondary sanctions often create friction between the U.S. and Europe because they reflect U.S. interference in the affairs and interests of the European Union (EU), and their increasing use is perceived in the EU as a violation of national and EU sovereignty. Secondary sanctions imposed on Iran and Russia are central to these tensions. Abdelal also argues that the U.S.'s overuse of sanctions risks gradual isolation and the continuing decline of U.S. influence in an emerging multipolar world. In June 2025, a majority of U.S. senators supported secondary sanctions against Russia that would impose 500% tariffs on countries that buy Russian oil, natural gas, uranium, and other exports. On July 31, 2025, the U.S. announced its first "secondary tariff," targeting India to penalize its trade with Russia, with Indian exports facing an extra 25% tariff beginning August 27, 2025.
A Civatte body (named after the French dermatologist Achille Civatte, 1877–1956) is a damaged basal keratinocyte that has undergone apoptosis, and consist largely of keratin intermediate filaments, and are almost invariably covered with immunoglobulins, mainly IgM. Civatte bodies are characteristically found in skin lesions of various dermatoses, particularly lichen planus and discoid lupus erythematosus. They may also be found in graft-versus-host disease, adverse drug reactions, inflammatory keratosis (such as lichenoid actinic keratosis and lichen planus-like keratosis), erythema multiforme, bullous pemphigoid, eczema, lichen planopilaris, febrile neutrophilic dermatosis, toxic epidermal necrolysis, herpes simplex and varicella zoster lesions, dermatitis herpetiformis, porphyria cutanea tarda, sarcoidosis, subcorneal pustular dermatosis, transient acantholytic dermatosis and epidermolytic hyperkeratosis.
== Bibliography == Cowie, J. M. G. (John McKenzie Grant) (1991). Polymers: chemistry and physics of modern materials. Glasgow: Blackie. ISBN 978-0-412-03121-2. Hall, Christopher (1989). Polymer materials (PDF) (2nd ed.). London; New York: Macmillan. ISBN 978-0-333-46379-6. Rudin, Alfred (1982). The elements of polymer science and engineering. Academic Press. ISBN 978-0-12-601680-2. Wright, David C. (2001). Environmental Stress Cracking of Plastics. RAPRA. ISBN 978-1-85957-064-7.
Dr. Reddy's originally launched in 1984 producing active pharmaceutical ingredients. In 1986, Reddy's started operations on branded formulations. Within a year Reddy's had launched Norilet, the company's first recognised brand in India. Soon, Dr. Reddy's obtained another success with Omez, its branded omeprazole – gastrointestinal ulcer and reflux oesophagitis medication – launched at half the price of other brands on the Indian market at that time. Within a year, Reddy's became the first Indian company to export the active ingredients for pharmaceuticals to Europe. In 1987, Reddy's started to transform itself from a supplier of pharmaceutical ingredients to other manufacturers into a manufacturer of pharmaceutical products. In 1999, Dr. Reddy's joined the Indian Pharmaceutical Alliance as a founding member in an effort to promote the development of generic drugs in India.
Sources: en.wikipedia.org
Cardarine is a common name for GW501516, a synthetic PPARδ agonist developed for research. It has not been approved as a medication in any country. It is classified as an unapproved drug and a prohibited substance in sport.
No. Cardarine is not an anabolic steroid; it belongs to a different chemical class that targets PPARδ. Steroids act primarily through androgen receptors, while cardarine acts through a nuclear receptor involved in metabolism.
Some rodent studies reported increased endurance and changes in fat metabolism after cardarine exposure. Long-term studies in animals also raised concerns about cancer in certain tissues. Human trial data are limited, so these findings cannot be directly translated to people.
It binds to and activates PPAR delta, a nuclear receptor that controls expression of genes related to fatty acid oxidation. This mechanism can alter energy metabolism in animal models. It is not a direct stimulant or fat-burning enzyme.